Translate this page into:
Effect of valproic acid on expression of apoptotic markers in HeLa cell line – An in vitro study
-
Received: ,
Accepted: ,
How to cite this article: Kar R, Almeida EA, Basak D, Roy A. Effect of valproic acid on expression of apoptotic markers in HeLa cell line – An in vitro study. Int J Mol Immuno Oncol. 2026;11:48-54. doi: 10.25259/IJMIO_36_2025
Abstract
Objectives:
Valproic acid (VPA), a widely used antiepileptic drug, is known to have histone deacetylase inhibitory activity. It has been reported to modulate gene expression in various cancer cell lines. Alterations in the balance between proapoptotic and anti-apoptotic factors play a crucial role in cancer cell survival. This in vitro study investigated the cytotoxic effects of VPA on HeLa cells and evaluated changes in the mRNA expression of selected apoptotic regulators.
Material and Methods:
HeLa cell line was cultured in Dulbecco’s modified eagle medium and was treated with increasing concentrations of VPA (6.25–400 mM) for 24 h. Cell viability was assessed using the MTT assay. The half-maximal inhibitory concentration was calculated with appropriate statistical analysis. mRNA expression of proapoptotic genes (p53 and Bax) and the anti-apoptotic gene (Survivin) were analyzed using real-time polymerase chain reaction (PCR) following treatment with 12.5, 25, and 50 mM VPA.
Results:
VPA exposure resulted in a statistically significant reduction in HeLa cell viability in a concentration-dependent manner. Quantitative PCR analysis demonstrated a dose-dependent increase in p53 and Bax mRNA expression, along with a corresponding decrease in Survivin mRNA levels, compared with untreated controls.
Conclusion:
The findings indicate that VPA exerts cytotoxic effects on HeLa cells and is associated with altered expression of key apoptotic regulatory genes. While these results suggest activation of apoptotic signaling at the transcriptional level, functional evaluation of apoptosis was not performed. Therefore, the observations are mechanistic and exploratory and may provide a basis for future studies.
Keywords
Apoptosis
Bax
HeLa
p53
Valproic acid
INTRODUCTION
Cancer is a leading cause of death globally. The basic defect in cancer is dysregulation in the cell cycle resulting in excessive cellular proliferation. The cell cycle is a tightly regulated process with multiple checkpoints in place to ensure accurate and reliable cell duplication. The body has inbuilt mechanisms that can scan and repair the genome or destroy the mutated cells. Apoptosis is one such pathway which drives physiological cell death. An intricate balance between proapoptotic (E.g., Bax, p53) and anti-apoptotic (E.g., Survivin) factors determines the cellular outcome. In a normal cell, the process is inhibited under the influence of anti-apoptotic factors and is only triggered in the presence of a stimuli (external or internal) through activation of potent proteases termed caspases.
Bax is a potent pro-apoptotic factor which activates the release of caspases from death antagonists through heterodimerization. In addition, it increases mitochondrial membrane permeability by forming transitional pores, leading to the release of apoptogenic factors into the cytoplasm and activation of executioner caspases.[1] The activity of pro-apoptotic Bax is transcriptionally up-regulated by p53.[2] Bax is also known to promote apoptosis induced by histone deacetylase (HDAC) inhibitors (E.g., Valproic Acid [VPA]), cytotoxic drugs and radiation which is mediated through p53.[3,4]
p53 aka guardian of the genome is an important tumor suppressor gene involved in cell cycle regulation. Before initiation of the cell cycle, p53 scans the genome for mutations, if detected it stalls the cell cycle there permitting the cell DNA repair mechanisms to repair the defect. If the defect cannot be repaired, p53 initiates the process of apoptosis thereby destroying the mutant cell.[5,6] Such is the importance of p53 that mutations affecting this gene are documented in all types of cancers.
The effects of pro-apoptotic factors are buffered by anti-apoptotic factors. Survivin is a main anti-apoptotic factor which is known to inhibit both the intrinsic and extrinsic pathway of apoptosis.[7-9] Survivin is believed to directly bind to caspase-9, a key executioner caspase, thereby inhibiting its activity. In addition, it suppresses the intrinsic (mitochondrial) apoptosis pathway by interacting with pro-apoptotic proteins such as Second Mitochondria-derived Activator of Caspases/Direct IAP-Binding protein with Low iso-electric point, which are released from the mitochondria.[10]
VPA is commonly used antiepileptic drug which is also known to have anti-neoplastic actions. VPA is documented to have HDAC inhibitory activity and is also reported to affect methylation of DNA in addition to its histone hyperacetylation effects.[11-15] All of these lead to gene silencing by decreasing the unpacking, transcription, and translations processes. In HeLa cells (a cervical cancer cell line), VPA is documented to promote histone acetylation and chromatin remodeling. A study reported that treating HeLa cells with 3.0 mM VPA for 24 h led to the deregulation of approximately 6% (1,625 genes) of the HeLa cell genome. Among these genes, many were associated with cell cycle regulation, with 1,074 genes being upregulated and 551 downregulated.[11]
Given the effects of VPA on gene and cell cycle regulation, this study was designed to demonstrate the cytotoxicity of VPA on HeLa cell line and study its effect on the expression of apoptotic markers (Survivin, Bax, and p53).
MATERIAL AND METHODS
Ethical consideration
As the study was done on cell line and did not involve active recruitment of human subject, informed consent was not required. Ethical clearance was granted by the Institutional Ethics Committee: Human Research (IEHCR-2022-54-10-R1).
Cell culture
HeLa cells were obtained from the laboratory of Dr. Sudip Sen, Professor, All India Institute of Medical Sciences, New Delhi. The cell line was originally procured from the American Type Culture Collection (ATCC, USA) and had been authenticated. Cells were routinely maintained under standard culture conditions and periodically monitored for contamination. Morphological monitoring did not reveal features suggestive of mycoplasma contamination; however, confirmatory molecular testing was not performed. The cells with passage 176 were cultured in Dulbecco’s modified Eagle medium (DMEM) (Sigma, USA) containing 10% fetal calf serum (FCS), 100 IU/mL penicillin, 100 μg/mL streptomycin, and 0.25 μg/mL of amphotericin and were incubated in humidified 5% CO2 at 37°C. The cells were seeded into T25 flasks.
Preparation of cell lines for cytotoxicity assay
HeLa cells were seeded into 96-well microtiter plates during the logarithmic growth phase and exposed to VPA (Sigma, USA) at seven concentrations. The cytotoxic effect was assessed following the exposure period as outlined below:
Seeding
HeLa cells cultured in T25 flasks with complete DMEM supplemented with 10% FCS and antibiotics were maintained at 37°C in a humidified incubator with 5% CO2. Upon reaching ~70% confluency, cells were detached using trypsin, resuspended in DMEM, and counted using an automated cell counter with trypan blue exclusion. Approximately 1 × 104 cells were plated per well in 96-well plates and incubated under standard conditions.
Treatment
Once cells reached exponential growth, they were treated with seven graded concentrations of VPA (400, 200, 100, 50, 25, 12.5, and 6.25 mM), each in quadruplicate. VPA was initially dissolved in DMEM containing FCS to a stock concentration of 400 mM and then serially diluted in the same medium. Control wells received an equal volume of DMEM with FCS and antibiotics without VPA.
MTT assay
After 24 h of VPA exposure, cell viability was assessed using the MTT assay. The medium was removed, and 28 μL of MTT solution (2 mg/mL) was added to each well, followed by incubation at 37°C for 1.5 h. The MTT solution was then discarded, and the resulting formazan crystals were solubilized with 130 μL of dimethyl sulfoxide. Plates were incubated at 37°C for 15 min with gentle shaking. Absorbance was measured at 550 nm using a microplate reader. The percentage inhibition of cell growth was calculated using the formula: Inhibition Rate= ([Mean OD of control – Mean OD of treatment]/Mean OD of Control) *100.
Treatment with VPA for morphological and gene expression studies
Cell treatment
HeLa cells were cultured for 24 h in DMEM supplemented with 10% FCS and VPA, which was dissolved in DMEM and diluted to final concentrations of 12.5, 25, and 50 mM. Untreated cells cultured under identical conditions served as controls.
Morphological observations
Morphological changes in both treated and control cells were examined using an inverted fluorescence microscope (Nikon, Japan). Representative micrographs were captured to document the observed alterations in cell morphology.
Expression studies
RNA isolation and cDNA synthesis
Total RNA was extracted from VPA-treated and control cells using Tri-reagent (WVR, USA) according to the manufacturer’s instructions. RNA concentration and purity were assessed using a NanoDrop spectrophotometer (Thermo Scientific, USA). Equal amounts of RNA from each sample were reverse transcribed into complementary DNA (cDNA) using the RevertAid First Strand cDNA Synthesis Kit (Thermo Scientific, USA).
Quantitative real-time PCR analysis
The expression levels of survivin, Bax, and p53 mRNA were quantified by real-time PCR using the CFX Connect™ Real-Time PCR Detection System (Bio-Rad, USA). Gene-specific primers used for amplification are listed in Table 1.
| Primer | Forward sequence (5’ to 3’) | Reverse sequence (5’ to 3’) |
|---|---|---|
| Survivin | AGAACTGGCCCTTCTTGGAGG | CTTTTTATGTTCCTCTATGGGGTC |
| Bax | TCCCCCCGAGAGGTCTTTT | CGGCCCCAGTTGAAGTTG |
| p53 | TAACAGTTCCTGCATGGGCGGC | AGGACAGGCACAAACACGCACC |
| 18S | GTAACCCGTTGAACCCCATT | CCATCCAATCGGTAGTAGCG |
Statistical analysis
Statistical analysis was performed using GraphPad Prism (version 10.1.2). For the MTT assay, data from three independent experimental replicates were expressed as mean ± standard deviation [SD]. One-way analysis of variance (ANOVA) followed by Dunnett’s post hoc test was used to compare VPA-treated groups with untreated control. Half-maximal inhibitory concentration (IC50) values were calculated using nonlinear regression analysis. P < 0.05 was considered statistically significant.
For quantitative real-time PCR experiments, reactions were performed in duplicate (technical replicates). Relative gene expression was calculated using the 2−ΔΔCt method with 18S rRNA as the endogenous control. Mean ΔCt and SD were calculated to assess assay reproducibility [Table 2]. As biological replicates were not available, inferential statistical testing was not performed for qPCR data, and results are interpreted as exploratory.
| VPA | Mean ΔCt±SD | ||
|---|---|---|---|
| Survivin | Bax | p53 | |
| Control | 16.53±0.00 | 12.42±0.06 | 11.24±0.01 |
| 12.5 mM | 16.87±0.03 | 15.17±0.04 | 14.18±0.03 |
| 25 mM | 17.84±0.00 | 14.13±0.00 | 14.04±0.03 |
| 50 mM | 19.50±0.01 | 13.25±0.03 | 11.86±0.03 |
VPA: Valproic acid, SD: Standard deviation
RESULTS
Morphological changes
Direct cytotoxic effects were observed at higher dose of VPA. Cells appeared crenated after 4 h with the presence of apoptotic bodies being clearly visible at 24 h. The cells stopped dividing, and their numbers decreased as some cells underwent apoptosis and lost attachment. There was no evident morphological change in the cells in the control flask after 24 h, as depicted in Figure 1.
![Microscopic changes in HeLa cells treated with VPA [(a) 12.5 mM, (b) 25 mM, (c) 50 mM] and (d) control flask.](/content/8/2026/11/1/img/IJMIO-11-048-g001.png)
- Microscopic changes in HeLa cells treated with VPA [(a) 12.5 mM, (b) 25 mM, (c) 50 mM] and (d) control flask.
MTT assay
Treatment of HeLa cells with VPA for 24 h resulted in a statistically significant, concentration-dependent increase in cytotoxicity. The mean percentage cytotoxicity increased from 18.3 ± 1.25% at 6.25 mM to 88.4 ± 0.95% at 400 mM. One-way ANOVA demonstrated a significant difference among treatment groups (F = 149.50, P < 0.001). Non-linear regression analysis of the dose–response curve yielded an IC50 value of 20.07 mM [Figure 2], indicating moderate cytotoxic potency of VPA in HeLa cells at 24 h.
- (a) Effect of valproic acid (VPA) on cell viability (% inhibition) as assessed by the MTT assay. Data are expressed as mean ± SD of three independent experimental replicates. (b) IC50 of VPA on HeLa cell line.
mRNA expression of regulators of the cell cycle: Survivin, Bax, and p53
Quantitative real-time PCR analysis demonstrated dose-dependent transcriptional modulation of apoptotic regulatory genes following VPA treatment. Survivin expression showed a progressive reduction with increasing VPA concentration [Figure 3a], whereas Bax and p53 exhibited altered expression patterns (increasing pattern) relative to untreated controls as depicted in Figure 3b and c, respectively. Relative expression levels were calculated using the 2−ΔΔCt method and are presented as mean ± SD of technical replicates [Table 2]. These results indicate transcriptional changes associated with VPA exposure and should be interpreted as exploratory trends.
- Relative mRNA expression of Survivin, Bax, and p53 following VPA treatment. Expression levels were normalized to 18S rRNA and fold change calculated using the 2−ΔΔCt method. (a) mRNA expression of Survivin in HeLa cells treated with 12.5, 25 and 50mM VPA in comparison to untreated cells. (b) mRNA expression of p53 in HeLa cells treated with 12.5, 25 and 50 mM VPA in comparison to untreated cells. (c) mRNA expression of Bax in HeLa cells treated with 12.5, 25 and 50mM VPA in comparison to untreated cells. VPA: Valproic acid.
DISCUSSION
The antitumor effects of anti-epileptic drugs have been an area of active interest with some studies documenting a better response to treatment in patients with adjuvant use of antiepileptics.[16] While the antitumor effects of VPA are well documented, there are very few studies that have documented its effect on apoptotic markers in HeLa cell line.
In this study, we observed a dose-dependent increase in the cytotoxicity of VPA on HeLa cells. This result corroborates with earlier research conducted not only in HeLa cells[17-19] but also across various other tumor cell lines.[20-25] Such consistent evidence has heightened interest among researchers exploring VPA as a potential anti-cancer agent, particularly for targeting cervical cancer. The chemotherapeutic action is attributed to its inhibitory effect on HDACs. VPA, in addition to inhibiting class I and II HDACs and promoting acetylation of histones H3 and H4,[18,26,27] is also known to enhance DNA methylation.[14] It can modify the methylation status of various lysine residues on histone H3, alongside its effects on histone acetylation.[11-15] These epigenetic alterations collectively reshape the cellular epigenetic landscape, leading to cell cycle arrest at the G1 phase.[14,15] One study reported that VPA doses near the therapeutic plasma range used for epilepsy do not induce changes in cell proliferation or chromosomal integrity.[12]
We also report a dose-dependent decrease in expression of anti-apoptotic gene, that is, Survivin in HeLa cells treated with VPA compared to untreated HeLa cells. Although the effects of VPA on Survivin mRNA expression have not been documented in HeLa cells, VPA has been shown to downregulate Survivin expression in breast, colon, and bladder cancer cell lines. Various mechanisms such as HDACII inhibition, p53 signaling modulation, APC-dependent transcriptional repression, and enhanced histone H3 acetylation have been used to explain these effects.[28-30]
This study also documented a dose-dependent increase in the mRNA expression of pro-apoptotic markers, namely, p53 and Bax. p53, a tumor suppressor gene, regulates several critical cellular processes including senescence, cell cycle progression, and apoptosis. In the context of apoptosis, p53 facilitates the production of proteins such as Bax that are involved in the release of mitochondrial cytochrome c.[2] These findings align with our results and may be attributed to the transcriptional activation function of p53. Upregulation of p53 in response to VPA exposure has similarly been observed in other cancer cell lines.[31] Mechanistically, VPA enhances the proapoptotic activity of p53 at the mitochondrial membrane by stabilizing its acetylation at lysine 120.[32] Once acetylated and activated, p53 translocates to the nucleus, where it regulates the expression of both pro- and anti-apoptotic genes, including Puma, Survivin, Bcl-2, and Bax.[3] However, some studies paint a contradictory picture. A study reported that the effects of VPA on apoptosis were not associated with the upregulation of p53.[33] Another study reported no change in expression of p53 in HeLa cell on treatment with VPA.[18] Similarly, another study reported a 1.85-fold decrease in p53 expression in HeLa cells treated 4 mM VPA for 72 h.[34] These varied effects of VPA on p53 expression could be a result of using different concentrations of VPA. In addition, VPA and other HDAC inhibitors are also known to promote apoptosis through the acetylation of p53 as reported by De et al.[35]
Therefore, the present study demonstrates that exposure of HeLa cells to VPA is associated with dose-dependent cytotoxicity and coordinated alterations in the transcriptional expression of key apoptotic regulators. Specifically, VPA treatment resulted in increased mRNA expression of p53 and Bax, along with reduced expression of the anti-apoptotic gene Survivin. These findings are consistent with previously reported effects of HDAC inhibitors on epigenetic modulation of apoptosis-related genes.
However, it is important to emphasize that the present observations are limited to transcriptional changes and morphological features suggestive of cellular stress. While altered expression of p53, Bax, and Survivin is commonly associated with apoptotic signaling, mRNA expression alone does not establish activation of apoptosis or delineate the specific apoptotic pathway involved. Functional validation using assays such as Annexin-V/PI staining, caspase activation assays, or protein-level analysis was not performed in the current study.
Furthermore, the concentrations of VPA used exceed therapeutic plasma levels and were selected to elicit measurable epigenetic and transcriptional responses in an in vitro setting. Accordingly, the findings should be interpreted as mechanistic rather than directly translational. Differences reported in the literature regarding the effect of VPA on p53 expression may be attributable to variations in drug concentration, exposure duration, cell type, and experimental conditions.
Taken together, the data suggest that VPA modulates the transcriptional balance of pro- and anti-apoptotic genes in HeLa cells, providing a molecular basis for its observed cytotoxic effects. These results support further investigation using physiologically relevant concentrations, additional cervical cancer models, and functional assays to better define the role of VPA in apoptosis and its potential utility in epigenetic-based cancer therapeutic strategies.
Limitations and future prospects
The present study has several limitations that should be acknowledged. First, the assessment of apoptosis was limited to transcriptional analysis of selected apoptotic markers, without functional or protein-level validation. In addition, gene expression analysis was based on technical replicates without biological replicates; therefore, the results reflect transcriptional trends rather than biological variability. Second, the concentrations of VPA used exceed therapeutic plasma levels and were selected for mechanistic evaluation in an in vitro system. Third, the use of a single cervical cancer cell line with a high passage number may influence gene expression profiles and limits generalizability. In addition, osmolarity-related effects at higher drug concentrations cannot be completely excluded.
Future studies should incorporate functional apoptosis assays, protein expression analysis, physiologically relevant drug concentrations, multiple cervical cancer models, and in vivo validation to better define the role of VPA in modulating apoptotic pathways and its potential therapeutic relevance.
CONCLUSION
The findings indicate that VPA exerts cytotoxic effects on HeLa cells and is associated with altered expression of key apoptotic regulatory genes. While these results suggest activation of apoptotic signaling at the transcriptional level, functional validation of apoptosis was not performed. Therefore, the observations should be interpreted as mechanistic and exploratory, providing a basis for future studies incorporating protein-level and functional assays.
Acknowledgment:
The HeLa cell line was received from Dr Sudip Sen’s Lab, Professor, AIIMS, New Delhi. The cell line originally procured from ATCC, USA is authenticated and periodically tested for any contamination. The authors would like to thank the Multidisciplinary Research Unit (MRU), UCMS, Delhi, for their assistance with cell culture.
Ethical approval:
The research/study approved by the Institutional Review Board at University College of Medical Sciences, number 2022-54-10-R1, dated 10th August, 2022.
Declaration of patient consent:
Patient’s consent was not required as there are no patients in this study.
Conflicts of interest:
There are no conflicts of interest.
Use of artificial intelligence (AI)-assisted technology for manuscript preparation:
The authors confirm that there was no use of artificial intelligence (AI)-assisted technology for assisting in the writing or editing of the manuscript and no images were manipulated using AI.
Financial support and sponsorship: Nil.
References
- Effects of biphasic and monophasic electrical stimulation on mitochondrial dynamics, cell apoptosis, and cell proliferation. J Cell Physiol. 2018;234:816-24.
- [CrossRef] [PubMed] [Google Scholar]
- How does p53 induce apoptosis and how does this relate to p53-mediated tumour suppression? Cell Death Differ. 2018;25:104-13.
- [CrossRef] [PubMed] [Google Scholar]
- Valproic acid induces the hyperacetylation of P53, expression of P53 target genes, and markers of the intrinsic apoptotic pathway in midorganogenesis murine limbs. Birth Defects Res B Dev Reprod Toxicol. 2015;104:177-83.
- [CrossRef] [PubMed] [Google Scholar]
- Hsp90 inhibitors promote p53-dependent apoptosis through PUMA and Bax. Mol Cancer Ther. 2013;12:2559-68.
- [CrossRef] [PubMed] [Google Scholar]
- p53 in health and disease. Nat Rev Mol Cell Biol. 2007;8:275-83.
- [CrossRef] [PubMed] [Google Scholar]
- Mutant p53: One name, many proteins. Genes Dev. 2012;26:1268-86.
- [CrossRef] [PubMed] [Google Scholar]
- IAP-family protein survivin inhibits caspase activity and apoptosis induced by Fas (CD95), Bax, caspases, and anticancer drugs. Cancer Res. 1998;58:5315-20.
- [Google Scholar]
- Survivin-deltaEx3 and survivin-2B: Two novel splice variants of the apoptosis inhibitor survivin with different antiapoptotic properties. Cancer Res. 1999;59:6097-102.
- [Google Scholar]
- The molecular basis and potential role of survivin in cancer diagnosis and therapy. Trends Mol Med. 2001;7:542-7.
- [CrossRef] [PubMed] [Google Scholar]
- Survivin: A bifunctional inhibitor of apoptosis protein. Vet Pathol. 2004;41:599-607.
- [CrossRef] [PubMed] [Google Scholar]
- Differential effects of class I isoform histone deacetylase depletion and enzymatic inhibition by belinostat or valproic acid in HeLa cells. Mol Cancer. 2008;7:70.
- [CrossRef] [PubMed] [Google Scholar]
- Chromatin remodeling, cell proliferation and cell death in valproic acid-treated HeLa cells. PLoS One. 2011;6:e29144.
- [CrossRef] [PubMed] [Google Scholar]
- DNA methylation changes in valproic acid-treated hela cells as assessed by image analysis, immunofluorescence and vibrational microspectroscopy. PLoS One. 2017;12:e0170740.
- [CrossRef] [PubMed] [Google Scholar]
- Sodium valproate and 5-aza-2'-deoxycytidine differentially modulate DNA demethylation in G1 phase-arrested and proliferative HeLa cells. Sci Rep. 2019;9:18236.
- [CrossRef] [PubMed] [Google Scholar]
- Sodium valproate modulates the methylation status of lysine residues 4, 9 and 27 in histone H3 of HeLa cells. Curr Mol Pharmacol. 2023;16:197-210.
- [CrossRef] [PubMed] [Google Scholar]
- The evidence for repurposing anti-epileptic drugs to target cancer. Mol Biol Rep. 2023;50:7667-80.
- [CrossRef] [PubMed] [Google Scholar]
- Anti-proliferative and apoptotic effects of valproic acid on HeLa cells. Int J Cancer Manag. 2022;15:e120224.
- [CrossRef] [Google Scholar]
- Valproic acid inhibits the growth of cervical cancer both in vitro and in vivo. J Biochem. 2008;144:357-62.
- [CrossRef] [PubMed] [Google Scholar]
- Valproic acid induces apoptosis and cell cycle arrest in poorly differentiated thyroid cancer cells. J Clin Endocrinol Metab. 2005;90:1383-9.
- [CrossRef] [PubMed] [Google Scholar]
- Valproic acid inhibits proliferation and reduces invasiveness in glioma stem cells through Wnt/ß catenin signalling activation. Genes (Basel). 2018;9:522.
- [CrossRef] [PubMed] [Google Scholar]
- GANT61 and valproic acid synergistically inhibited multiple myeloma cell proliferation via hedgehog signaling pathway. Med Sci Monit. 2020;26:e920541.
- [CrossRef] [Google Scholar]
- Influence of the HDAC inhibitor valproic acid on the growth and proliferation of temsirolimus-resistant prostate cancer cells in vitro. Cancers (Basel). 2019;11:566.
- [CrossRef] [PubMed] [Google Scholar]
- Magnesium in combinatorial with valproic acid suppressed the proliferation and migration of human bladder cancer cells. Front Oncol. 2020;10:589112.
- [CrossRef] [PubMed] [Google Scholar]
- Evaluation of the effects of valproic acid treatment on cell survival and epithelialmesenchymal transition-related features of human gastric cancer cells. J Gastrointest Cancer. 2021;52:676-81.
- [CrossRef] [PubMed] [Google Scholar]
- Valproic acid decreases urothelial cancer cell proliferation and induces thrombospondin-1 expression. BMC Urol. 2012;12:21.
- [CrossRef] [PubMed] [Google Scholar]
- Histone deacetylase is a direct target of valproic acid, a potent anticonvulsant, mood stabilizer, and teratogen. J Biol Chem. 2001;276:36734-41.
- [CrossRef] [PubMed] [Google Scholar]
- Histone deacetylase is a target of valproic acid-mediated cellular differentiation. Cancer Res. 2004;64:1079-86.
- [CrossRef] [PubMed] [Google Scholar]
- Inhibitory effect of valproic acid on bladder cancer in combination with chemotherapeutic agents in vitro and in vivo. Oncol Lett. 2013;6:1492-8.
- [CrossRef] [PubMed] [Google Scholar]
- VPA inhibits breast cancer cell migration by specifically targeting HDAC2 and down-regulating Survivin. Mol Cell Biochem. 2012;361:39-45.
- [CrossRef] [PubMed] [Google Scholar]
- Adenomatous polyposis coli determines sensitivity to histone deacetylase inhibitor-induced apoptosis in colon cancer cells. Cancer Res. 2006;66:9245-51.
- [CrossRef] [PubMed] [Google Scholar]
- Effect of valproic acid on the class i histone deacetylase 1, 2 and 3, tumor suppressor Genes p21WAF1/CIP1 and p53, and intrinsic mitochondrial apoptotic pathway, pro-(Bax, Bak, and Bim) and anti-(Bcl-2, Bcl-xL, and Mcl-1) apoptotic genes expression, cell viability, and apoptosis induction in hepatocellular carcinoma HepG2 cell line. Asian Pac J Cancer Prev. 2021;22:89-95.
- [CrossRef] [PubMed] [Google Scholar]
- Low-dose valproic acid enhances radiosensitivity of prostate cancer through acetylated p53-dependent modulation of mitochondrial membrane potential and apoptosis. Mol Cancer Res. 2011;9:448-61.
- [CrossRef] [PubMed] [Google Scholar]
- Valproic acid induces growth arrest, apoptosis, and senescence in medulloblastomas by increasing histone hyperacetylation and regulating expression of p21Cip1, CDK4, and CMYC. Mol Cancer Ther. 2005;4:1912-22.
- [CrossRef] [PubMed] [Google Scholar]
- Valproic acid suppresses cervical cancer tumor progression possibly via activating Notch1 signaling and enhances receptor-targeted cancer chemotherapeutic via activating somatostatin receptor type II. Arch Gynecol Obstet. 2013;288:393-400.
- [CrossRef] [PubMed] [Google Scholar]
- A new synthetic histone deacetylase inhibitor, MHY2256, induces apoptosis and autophagy cell death in endometrial cancer cells via p53 acetylation. Int J Mol Sci. 2018;19:2743.
- [CrossRef] [PubMed] [Google Scholar]